pLV-H2B-iRFP670-p2a-mCerulean-Cdt1 (1-100)-IRES-puromycin
(Plasmid
#223965)
-
PurposeDual fluorescent reporter for histone H2B and for Cdt1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223965 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLV-EF1a-IRES-puromycin
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer For H2B-iRFP670: ccatttcaggtgtcgtgaggatccgccaccATGCCAGAGCCAGCGAAGTCT; For p2a-mCerulean-Cdt1: caccaacgcctgtacaagggttccggagc
- 3′ sequencing primer For H2B-iRFP670: cttgtacaggcgttggtggtgggcgg; For Cdt1: gcccgtcgactctagagcggccgccctcgaggaattcTTAtttctttatcttctggcccggagaaggg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-H2B-iRFP670-p2a-mCerulean-Cdt1 (1-100)-IRES-puromycin was a gift from Hee Won Yang (Addgene plasmid # 223965 ; http://n2t.net/addgene:223965 ; RRID:Addgene_223965) -
For your References section:
Non-canonical pathway for Rb inactivation and external signaling coordinate cell-cycle entry without CDK4/6 activity. Zhang M, Kim S, Yang HW. Nat Commun. 2023 Nov 29;14(1):7847. doi: 10.1038/s41467-023-43716-y. 10.1038/s41467-023-43716-y PubMed 38030655