AiP1999 - pAAV-AiE2255m-minBG-iCre(R297T)-BGHpA
(Plasmid
#223843)
-
PurposeEnhancer-driven expression of the iCre(R297T) recombinase in thalamic PVT neurons
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223843 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Total vector size (bp) 5016
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiCre(R297T)
-
SpeciesSynthetic
-
Insert Size (bp)1056
-
MutationArgenine in aa297 was replaced with Threonine
- Promoter minBG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GTTGCCAGCCATCTGTTGTTTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AiP1999 - pAAV-AiE2255m-minBG-iCre(R297T)-BGHpA was a gift from Bosiljka Tasic (Addgene plasmid # 223843 ; http://n2t.net/addgene:223843 ; RRID:Addgene_223843)