pGECPL.BC10.MG
(Plasmid #223822)

• Purpose: Contains Cas9-editable barcode, marking guide (MG) for lineage tracing, Cre for Cas9 activation and loxP-mediated gene deletion, and Firefly Luciferase (FLuc) for live luminescence-based monitoring.
• Depositing Lab: Dawid Nowak
• Publication: Serio et al Cancer Discov. 2024 Jul 5. doi: 10.1158/2159-8290.CD-23-1332.

Backbone

• Vector backbone: pECPV (EF1a-Cas9-P2A-Venus)
• Backbone size w/o insert (bp): 14999
• Total vector size (bp): 11325
• Vector type: Mammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, CRISPR, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Ef1a-Driven Cre-P2A-FLuc
• gRNA/shRNA sequence: TCTACACGCGCGTTCAACCG
• Promoter: Ef1a
• Tag / Fusion Protein:
  • P2A

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CCGAGGGTGGGGGAGAAC
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • Clonal Lineage Tracing with Somatic Delivery of Recordable Barcodes Reveals Migration Histories of Metastatic Prostate Cancer

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry