pcDNA3.1-Flag-Jarid2-polyA
(Plasmid
#223811)
-
PurposeIVT of Flag-Jarid2 mRNA with polyA tail, by the T7 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223811 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1-polyA
-
Vector typeMammalian Expression ; In vitro transcription
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameJarid2
-
SpeciesM. musculus (mouse)
-
Entrez GeneJarid2 (a.k.a. Jmj, jumonji)
- Promoter CMV, T7
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CACTGCTTACTGGCTTATCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-Flag-Jarid2-polyA was a gift from Azusa Inoue (Addgene plasmid # 223811 ; http://n2t.net/addgene:223811 ; RRID:Addgene_223811) -
For your References section:
H3K27 dimethylation dynamics reveal stepwise establishment of facultative heterochromatin in early mouse embryos. Matsuwaka M, Kumon M, Inoue A. Nat Cell Biol. 2025 Jan;27(1):28-38. doi: 10.1038/s41556-024-01553-1. Epub 2024 Oct 31. 10.1038/s41556-024-01553-1 PubMed 39482357