pHR-SFFV-FLAG-TurboID-dUBA-SQSTM1
(Plasmid
#223717)
-
PurposeExpresses FLAG-TurboID-dUBA-SQSTM1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223717 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHR-SFFV
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSQSTM1
-
SpeciesH. sapiens (human)
-
Mutationdeletion 384-Stop codon
-
Entrez GeneSQSTM1 (a.k.a. A170, DMRV, EBIAP, FTDALS3, NADGP, OSIL, PDB3, ZIP3, p60, p62, p62B)
- Promoter SFFV
-
Tag
/ Fusion Protein
- TurboID (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer ggtggcagtggatctcgagtcatggcgtcgctcaccgtgaag
- 3′ sequencing primer gttatctagatccggtggatccTTAgtacaaggcagcttccttcagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.12.12.571324 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-SFFV-FLAG-TurboID-dUBA-SQSTM1 was a gift from Benjamin Wolozin (Addgene plasmid # 223717 ; http://n2t.net/addgene:223717 ; RRID:Addgene_223717) -
For your References section:
Proximity labeling reveals dynamic changes in the SQSTM1 protein network. Ortiz ANR, Zhang L, Ash PEA, Basu A, Puri S, van der Spek SJF, Wang Z, Dorrian L, Emili A, Wolozin B. bioRxiv [Preprint]. 2024 Jun 27:2023.12.12.571324. doi: 10.1101/2023.12.12.571324. 10.1101/2023.12.12.571324 PubMed 38168279