Skip to main content
Addgene

pC0043-PspCas13b-gRNA non target
(Plasmid #223698)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223698 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pC0043
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA target sequence for luciferase control
  • gRNA/shRNA sequence
    CCTGAGATTCCTGGGTTCAAGGACTTGGAGCCCATGGAGCAGTTCATCGC

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC0043-PspCas13b-gRNA non target was a gift from Chuan He (Addgene plasmid # 223698 ; http://n2t.net/addgene:223698 ; RRID:Addgene_223698)

  • For your References section:

    FTO mediates LINE1 m(6)A demethylation and chromatin regulation in mESCs and mouse development. Wei J, Yu X, Yang L, Liu X, Gao B, Huang B, Dou X, Liu J, Zou Z, Cui XL, Zhang LS, Zhao X, Liu Q, He PC, Sepich-Poore C, Zhong N, Liu W, Li Y, Kou X, Zhao Y, Wu Y, Cheng X, Chen C, An Y, Dong X, Wang H, Shu Q, Hao Z, Duan T, He YY, Li X, Gao S, Gao Y, He C. Science. 2022 May 27;376(6596):968-973. doi: 10.1126/science.abe9582. Epub 2022 May 5. 10.1126/science.abe9582 PubMed 35511947
Related items: