mTph2p(330bp)-mut1-Luc
(Plasmid
#223664)
-
PurposeFirefly-luciferase reporter expression driven by proximal 330-bp of mouse Tph2 promoter point mutation at RRE site 1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223664 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGL3
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemTph2 promoter
-
SpeciesM. musculus (mouse)
-
Entrez GeneTph2 (a.k.a. Ntph)
- Promoter mTph2 promoter
-
Tag
/ Fusion Protein
- Firefly luciferase (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATCGATAGGTACCGAGCTCTTACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mTph2p(330bp)-mut1-Luc was a gift from Kyungjin Kim (Addgene plasmid # 223664 ; http://n2t.net/addgene:223664 ; RRID:Addgene_223664) -
For your References section:
Role of the circadian nuclear receptor REV-ERBalpha in dorsal raphe serotonin synthesis in mood regulation. Park I, Choi M, Kim J, Jang S, Kim D, Kim J, Choe Y, Geum D, Yu SW, Choi JW, Moon C, Choe HK, Son GH, Kim K. Commun Biol. 2024 Aug 15;7(1):998. doi: 10.1038/s42003-024-06647-y. 10.1038/s42003-024-06647-y PubMed 39147805