pNHA13
(Plasmid
#223645)
-
PurposeExpression of mxiE-turboID fusion
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223645 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepUC18.1rp
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemxiE
-
Entrez GenemxiE (a.k.a. D742_p5051)
- Promoter rpsM
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer caggaaacagctatgaccatg
- 3′ sequencing primer tgtaaaacgacggccagt (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameturboID
-
SpeciesSynthetic
- Promoter rpsM
-
Tag
/ Fusion Protein
- Myc (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer caggaaacagctatgaccatg
- 3′ sequencing primer tgtaaaacgacggccagt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNHA13 was a gift from François-Xavier Campbell-Valois (Addgene plasmid # 223645 ; http://n2t.net/addgene:223645 ; RRID:Addgene_223645) -
For your References section:
The promiscuous biotin ligase TurboID reveals the proxisome of the T3SS chaperone IpgC in Shigella flexneri. Haidar-Ahmad N, Tomaro K, Lavallée-Adam M, Campbell-Valois F. 0.. mSphere 0:e00553-24 10.1128/msphere.00553-24