Skip to main content
Addgene

pcDNA-mGFP-Eps15DN
(Plasmid #223621)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223621 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Eps15
  • Species
    H. sapiens (human)
  • Mutation
    Eps15 _ 95-295aa
  • Entrez Gene
    EPS15 (a.k.a. AF-1P, AF1P, MLLT5)
  • Tag / Fusion Protein
    • mGFP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer gaaatttgtgatgctattgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid lab code: L1977

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA-mGFP-Eps15DN was a gift from Enfu Hui (Addgene plasmid # 223621 ; http://n2t.net/addgene:223621 ; RRID:Addgene_223621)
  • For your References section:

    cis-B7:CD28 interactions at invaginated synaptic membranes provide CD28 co-stimulation and promote CD8(+) T cell function and anti-tumor immunity. Zhao Y, Caron C, Chan YY, Lee CK, Xu X, Zhang J, Masubuchi T, Wu C, Bui JD, Hui E. Immunity. 2023 Jun 13;56(6):1187-1203.e12. doi: 10.1016/j.immuni.2023.04.005. Epub 2023 May 8. 10.1016/j.immuni.2023.04.005 PubMed 37160118