Skip to main content
Addgene

pHR-CD28
(Plasmid #223596)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223596 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHR
  • Vector type
    Lentiviral ; Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD28
  • Species
    H. sapiens (human)
  • Entrez Gene
    CD28 (a.k.a. Tp44)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ccaatcagcctgcttctcgcttc
  • 3′ sequencing primer ccagaggttgattatcgataagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid lab code: L1318

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-CD28 was a gift from Enfu Hui (Addgene plasmid # 223596 ; http://n2t.net/addgene:223596 ; RRID:Addgene_223596)
  • For your References section:

    cis-B7:CD28 interactions at invaginated synaptic membranes provide CD28 co-stimulation and promote CD8(+) T cell function and anti-tumor immunity. Zhao Y, Caron C, Chan YY, Lee CK, Xu X, Zhang J, Masubuchi T, Wu C, Bui JD, Hui E. Immunity. 2023 Jun 13;56(6):1187-1203.e12. doi: 10.1016/j.immuni.2023.04.005. Epub 2023 May 8. 10.1016/j.immuni.2023.04.005 PubMed 37160118