Skip to main content
Addgene

pPPI4-Strep-SNAP-PD-L2-His10
(Plasmid #223578)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223578 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pPPI4
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PD-L2
  • Species
    H. sapiens (human)
  • Entrez Gene
    PDCD1LG2 (a.k.a. B7DC, Btdc, CD273, PD-L2, PDCD1L2, PDL2, bA574F11.2)
  • Tags / Fusion Proteins
    • Twin-Strep, SNAP (N terminal on insert)
    • His10 (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCAGTGTAGTCTGAGCAGTAC
  • 3′ sequencing primer GCTGGCAACTAGAAGGCACAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid lab code: L483

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPPI4-Strep-SNAP-PD-L2-His10 was a gift from Enfu Hui (Addgene plasmid # 223578 ; http://n2t.net/addgene:223578 ; RRID:Addgene_223578)
  • For your References section:

    PD-L1:CD80 Cis-Heterodimer Triggers the Co-stimulatory Receptor CD28 While Repressing the Inhibitory PD-1 and CTLA-4 Pathways. Zhao Y, Lee CK, Lin CH, Gassen RB, Xu X, Huang Z, Xiao C, Bonorino C, Lu LF, Bui JD, Hui E. Immunity. 2019 Dec 17;51(6):1059-1073.e9. doi: 10.1016/j.immuni.2019.11.003. Epub 2019 Nov 19. 10.1016/j.immuni.2019.11.003 PubMed 31757674