Skip to main content
Addgene

pHR-CLIP-PD-L1
(Plasmid #223571)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223571 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pHR
  • Vector type
    Lentiviral ; Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PD-L1
  • Species
    H. sapiens (human)
  • Entrez Gene
    CD274 (a.k.a. B7-H, B7H1, PD-L1, PDCD1L1, PDCD1LG1, PDL1, hPD-L1)
  • Tag / Fusion Protein
    • CLIP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ccaatcagcctgcttctcgcttc
  • 3′ sequencing primer ccagaggttgattatcgataagc
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid lab code: L604

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-CLIP-PD-L1 was a gift from Enfu Hui (Addgene plasmid # 223571 ; http://n2t.net/addgene:223571 ; RRID:Addgene_223571)

  • For your References section:

    Antigen-Presenting Cell-Intrinsic PD-1 Neutralizes PD-L1 in cis to Attenuate PD-1 Signaling in T Cells. Zhao Y, Harrison DL, Song Y, Ji J, Huang J, Hui E. Cell Rep. 2018 Jul 10;24(2):379-390.e6. doi: 10.1016/j.celrep.2018.06.054. 10.1016/j.celrep.2018.06.054 PubMed 29996099
Related items: