Skip to main content
Addgene

pLJM1-PHD2
(Plasmid #223552)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223552 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLJM1
  • Backbone size w/o insert (bp) 7315
  • Total vector size (bp) 8643
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PHD2
  • Alt name
    EGLN1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1328
  • Entrez Gene
    EGLN1 (a.k.a. C1orf12, ECYT3, HALAH, HIF-PH2, HIFPH2, HPH-2, HPH2, PHD2, SM20, ZMYND6)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer gacgtgaagaatgtgcgaga
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLJM1-PHD2 was a gift from Somshuvra Mukhopadhyay (Addgene plasmid # 223552 ; http://n2t.net/addgene:223552 ; RRID:Addgene_223552)
  • For your References section:

    PHD2 enzyme is an intracellular manganese sensor that initiates the homeostatic response against elevated manganese. Gurol KC, Jursa T, Cho EJ, Fast W, Dalby KN, Smith DR, Mukhopadhyay S. Proc Natl Acad Sci U S A. 2024 Jun 25;121(26):e2402538121. doi: 10.1073/pnas.2402538121. Epub 2024 Jun 21. 10.1073/pnas.2402538121 PubMed 38905240