Skip to main content
Addgene

pLentiCRISPR v2 puro hGSDME gRNA1
(Plasmid #223519)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223519 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLentiCRISPR v2
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GSDME
  • gRNA/shRNA sequence
    TAAGTTACAGCTTCTAAGTC
  • Species
    H. sapiens (human)
  • Entrez Gene
    GSDME (a.k.a. DFNA5, ICERE-1)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPR v2 puro hGSDME gRNA1 was a gift from Judy Lieberman (Addgene plasmid # 223519 ; http://n2t.net/addgene:223519 ; RRID:Addgene_223519)
  • For your References section:

    Gasdermin E suppresses tumour growth by activating anti-tumour immunity. Zhang Z, Zhang Y, Xia S, Kong Q, Li S, Liu X, Junqueira C, Meza-Sosa KF, Mok TMY, Ansara J, Sengupta S, Yao Y, Wu H, Lieberman J. Nature. 2020 Mar;579(7799):415-420. doi: 10.1038/s41586-020-2071-9. Epub 2020 Mar 11. 10.1038/s41586-020-2071-9 PubMed 32188940