pDUP2
(Plasmid #223517)

• Purpose: cogfp copy 1 under control of Ptet, cogfp copy 2 under control of Ptac
• Depositing Lab: Yolanda Schaerli
• Publication: Ljiljana et al eLife13:RP97216

Backbone

• Vector backbone: pEXT20
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: CoGFP
• Species: Cavernularia obesa
• Insert Size (bp): 690
• Mutation: anti-dimerization mutations S129G, 22 C154S, D156G, K204I, and N209Y
• Promoter: Ptet
• Tag / Fusion Protein:
  • His tag (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: SacI (not destroyed)
• 5′ sequencing primer: GAGTTGTAAAACGACGGCCAG

Gene/Insert 2

• Gene/Insert name: CoGFP (second copy)
• Species: Cavernularia obesa
• Mutation: anti-dimerization mutations S129G, 22 C154S, D156G, K204I, and N209Y
• Promoter: Ptac
• Tag / Fusion Protein:
  • His tag (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: NcoI (not destroyed)
• 5′ sequencing primer: GCCGTCACTGCGTCTTTTAC

Resource Information

• Supplemental Documents:
  • pdup2.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

These plasmids contain repetitive genes, oriented facing each other, and therefore PCR and next generation sequencing may fail due to the special nature of the plasmids, however the function is not affected.