pDUP
(Plasmid
#223515)
-
Purposecogfp under control of Ptac
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223515 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEXT20
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCoGFP
-
SpeciesCavernularia obesa
-
Insert Size (bp)690
- Promoter Ptac
-
Tag
/ Fusion Protein
- His tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer GCCGTCACTGCGTCTTTTAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDUP was a gift from Yolanda Schaerli (Addgene plasmid # 223515 ; http://n2t.net/addgene:223515 ; RRID:Addgene_223515) -
For your References section:
A direct experimental test of Ohno’s hypothesis. Ljiljana Mihajlovic, Bharat Ravi Iyengar, Florian Baier, Içvara Barbier, Justyna Iwaszkiewicz, Vincent Zoete, Andreas Wagner, Yolanda Schaerli. eLife13:RP97216 10.7554/eLife.97216.1