Skip to main content
Addgene

pTrc-clbS_Bifido
(Plasmid #223359)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223359 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTrcHis 2A
  • Backbone manufacturer
    Thermofisher scientific
  • Backbone size w/o insert (bp) 4257
  • Total vector size (bp) 4797
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Encoding ClbS from Bifidobacterium longum subsp. infantis (Codon optimized for E coli)
  • Species
    Bifidobacterium longum subsp. infantis
  • Insert Size (bp)
    540
  • Promoter pTrc

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGAAAAAGCGAAGCGGCACTGCT
  • 3′ sequencing primer GCATGGGGTCAGGTGGGACC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTrc-clbS_Bifido was a gift from Emily Balskus (Addgene plasmid # 223359 ; http://n2t.net/addgene:223359 ; RRID:Addgene_223359)
  • For your References section:

    The bacterial toxin colibactin triggers prophage induction. Silpe JE, Wong JWH, Owen SV, Baym M, Balskus EP. Nature. 2022 Mar;603(7900):315-320. doi: 10.1038/s41586-022-04444-3. Epub 2022 Feb 23. 10.1038/s41586-022-04444-3 PubMed 35197633