pAAV_hU6p_shRNA-mErbb4-#3_mSyn1p_EGFP
(Plasmid
#223311)
-
PurposeshRNA for mouse Erbb4
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223311 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshErbb4
-
gRNA/shRNA sequenceGAGAATAGTGATCCGAGATAA
-
SpeciesM. musculus (mouse)
-
Entrez GeneErbb4 (a.k.a. Her4, c-erbB-4)
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site SpeI (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV_hU6p_shRNA-mErbb4-#3_mSyn1p_EGFP was a gift from Michael Wehr (Addgene plasmid # 223311 ; http://n2t.net/addgene:223311 ; RRID:Addgene_223311) -
For your References section:
Polypharmacological profiling across protein target families and cellular pathways using the multiplexed cell-based assay platform safetyProfiler reveals efficacy, potency and side effects of drugs. Popovic L, Brankatschk B, Palladino G, Rossner MJ, Wehr MC. Biomed Pharmacother. 2024 Nov;180:117523. doi: 10.1016/j.biopha.2024.117523. Epub 2024 Oct 14. 10.1016/j.biopha.2024.117523 PubMed 39405910