pAAV_hU6p_shRNA-mErbb4-#1_mSyn1p_EGFP
(Plasmid #223309)

• Purpose: shRNA for mouse Erbb4
• Depositing Lab: Michael Wehr
• Publication: Popovic et al Biomed Pharmacother. 2024 Nov;180:117523. doi: 10.1016/j.biopha.2024.117523. Epub 2024 Oct 14.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: shErbb4
• gRNA/shRNA sequence: CTGGAGAATTTACGCATTATT
• Species: M. musculus (mouse)
• Entrez Gene: Erbb4 (a.k.a. Her4, c-erbB-4)
• Tag / Fusion Protein:
  • EGFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (unknown if destroyed)
• 3′ cloning site: SpeI (unknown if destroyed)

Resource Information

• Supplemental Documents:
  • pAAV_hU6p_shRNA-mErbb4-#1_mSyn1p_EGFP.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry