Skip to main content
Addgene

pAAV_hU6p_shRNA-mErbb4-#1_mSyn1p_EGFP
(Plasmid #223309)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223309 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shErbb4
  • gRNA/shRNA sequence
    CTGGAGAATTTACGCATTATT
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Erbb4 (a.k.a. Her4, c-erbB-4)
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site SpeI (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_hU6p_shRNA-mErbb4-#1_mSyn1p_EGFP was a gift from Michael Wehr (Addgene plasmid # 223309 ; http://n2t.net/addgene:223309 ; RRID:Addgene_223309)
  • For your References section:

    Polypharmacological profiling across protein target families and cellular pathways using the multiplexed cell-based assay platform safetyProfiler reveals efficacy, potency and side effects of drugs. Popovic L, Brankatschk B, Palladino G, Rossner MJ, Wehr MC. Biomed Pharmacother. 2024 Nov;180:117523. doi: 10.1016/j.biopha.2024.117523. Epub 2024 Oct 14. 10.1016/j.biopha.2024.117523 PubMed 39405910