pET29a-human histone 4-in-One
(Plasmid #223237)

• Purpose: Polycistronic bacterial coexpression construct for human His-Sumo-H2A, H2B, H3, and Dual-StrepII-H4
• Depositing Lab: Weixing Zhao
• Publication: STAR-protocols--Evaluating the E3 Ligase Activity of BRCA1-BARD1 and its Variants by Nucleosomal Histone Ubiquitylation (unpublished)

Backbone

• Vector backbone: pET29a
• Backbone size w/o insert (bp): 5371
• Total vector size (bp): 7003
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: His6-VSVG-Histone H2A
• Species: H. sapiens (human)
• Insert Size (bp): 441
• Promoter: T7
• Tags / Fusion Proteins:
  • His6 (N terminal on insert)
  • VSVG (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Other
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Gene/Insert 2

• Gene/Insert name: Histone H2B
• Species: H. sapiens (human)
• Insert Size (bp): 498
• Promoter: T7

Cloning Information for Gene/Insert 2

• Cloning method: Other
• 5′ sequencing primer: AACCCGTATCATCCCGCG

Gene/Insert 3

• Gene/Insert name: Histone H3
• Species: H. sapiens (human)
• Insert Size (bp): 339
• Mutation: A103G
• Promoter: T7

Cloning Information for Gene/Insert 3

• Cloning method: Other
• 5′ sequencing primer: GATGTTGTCACGCAGAAC

Gene/Insert 4

• Gene/Insert name: Histone H4-TEV-His6-Dual StrepII
• Species: H. sapiens (human)
• Insert Size (bp): 354
• Promoter: T7
• Tags / Fusion Proteins:
  • TEV protease site (C terminal on insert)
  • Dual StrepII (C terminal on insert)
  • His6 (C terminal on insert)

Cloning Information for Gene/Insert 4

• Cloning method: Other
• 5′ sequencing primer: AGGCCAGCGAGGCTTATC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry