pET29a-human histone 4-in-One
(Plasmid
#223237)
-
PurposePolycistronic bacterial coexpression construct for human His-Sumo-H2A, H2B, H3, and Dual-StrepII-H4
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223237 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET29a
- Backbone size w/o insert (bp) 5371
- Total vector size (bp) 7003
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameHis6-VSVG-Histone H2A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)441
- Promoter T7
-
Tags
/ Fusion Proteins
- His6 (N terminal on insert)
- VSVG (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Other
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHistone H2B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)498
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Other
- 5′ sequencing primer AACCCGTATCATCCCGCG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameHistone H3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)339
-
MutationA103G
- Promoter T7
Cloning Information for Gene/Insert 3
- Cloning method Other
- 5′ sequencing primer GATGTTGTCACGCAGAAC (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameHistone H4-TEV-His6-Dual StrepII
-
SpeciesH. sapiens (human)
-
Insert Size (bp)354
- Promoter T7
-
Tags
/ Fusion Proteins
- TEV protease site (C terminal on insert)
- Dual StrepII (C terminal on insert)
- His6 (C terminal on insert)
Cloning Information for Gene/Insert 4
- Cloning method Other
- 5′ sequencing primer AGGCCAGCGAGGCTTATC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET29a-human histone 4-in-One was a gift from Weixing Zhao (Addgene plasmid # 223237 ; http://n2t.net/addgene:223237 ; RRID:Addgene_223237)