pAAV-U6-sgRev-erba-hSyn-mCherry-KASH
(Plasmid
#223226)
-
PurposeguideRNA targeting the mouse Rev-erb alpha (Nr1d1)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223226 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-U6-sgRNA-hSyn-mCherry-KASH
- Backbone size w/o insert (bp) 5270
- Total vector size (bp) 5293
-
Modifications to backboneDestroyed SapI digestion site
-
Vector typeMammalian Expression, Mouse Targeting, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNr1d1
-
Alt nameRev-erb alpha
-
gRNA/shRNA sequenceGTTGCGATTGATGCGAACGATGG
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_145434.4
-
Entrez GeneNr1d1 (a.k.a. A530070C09Rik)
- Promoter U6
-
Tag
/ Fusion Protein
- mCherry
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGC ACG CGT GAG GGC CTA TT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-U6-sgRev-erba-hSyn-mCherry-KASH was a gift from Kyungjin Kim (Addgene plasmid # 223226 ; http://n2t.net/addgene:223226 ; RRID:Addgene_223226) -
For your References section:
Role of the circadian nuclear receptor REV-ERBalpha in dorsal raphe serotonin synthesis in mood regulation. Park I, Choi M, Kim J, Jang S, Kim D, Kim J, Choe Y, Geum D, Yu SW, Choi JW, Moon C, Choe HK, Son GH, Kim K. Commun Biol. 2024 Aug 15;7(1):998. doi: 10.1038/s42003-024-06647-y. 10.1038/s42003-024-06647-y PubMed 39147805