pAAV-U6-sgRev-erba-hSyn-mCherry-KASH
(Plasmid #223226)

• Purpose: guideRNA targeting the mouse Rev-erb alpha (Nr1d1)
• Depositing Lab: Kyungjin Kim
• Publication: Park et al Commun Biol. 2024 Aug 15;7(1):998. doi: 10.1038/s42003-024-06647-y.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-U6-sgRNA-hSyn-mCherry-KASH
• Backbone size w/o insert (bp): 5270
• Total vector size (bp): 5293
• Modifications to backbone: Destroyed SapI digestion site
• Vector type: Mammalian Expression, Mouse Targeting, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Nr1d1
• Alt name: Rev-erb alpha
• gRNA/shRNA sequence: GTTGCGATTGATGCGAACGATGG
• Species: M. musculus (mouse)
• GenBank ID: NM_145434.4
• Entrez Gene: Nr1d1 (a.k.a. A530070C09Rik)
• Promoter: U6
• Tag / Fusion Protein:
  • mCherry

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGC ACG CGT GAG GGC CTA TT

Resource Information

• Supplemental Documents:
  • paav-u6-nr1d1-sgRNA-hsyn-mcherry-kash.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry