pAAV-GFAP-eGFP-shAqp4-3
(Plasmid
#223224)
-
Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223224 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV.GFAP.eGFP.WPRE.hGH
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshAqp4
-
gRNA/shRNA sequenceCGAACTGATGTTACTGGTTCAA (the first C was added to the shRNA seq in order to have 22 mer)
-
SpeciesM. musculus (mouse)
-
Entrez GeneAqp4 (a.k.a. WCH4)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-GFAP-eGFP-shAqp4-3 was a gift from Li-Huei Tsai (Addgene plasmid # 223224 ; http://n2t.net/addgene:223224 ; RRID:Addgene_223224) -
For your References section:
Multisensory gamma stimulation promotes glymphatic clearance of amyloid. Murdock MH, Yang CY, Sun N, Pao PC, Blanco-Duque C, Kahn MC, Kim T, Lavoie NS, Victor MB, Islam MR, Galiana F, Leary N, Wang S, Bubnys A, Ma E, Akay LA, Sneve M, Qian Y, Lai C, McCarthy MM, Kopell N, Kellis M, Piatkevich KD, Boyden ES, Tsai LH. Nature. 2024 Mar;627(8002):149-156. doi: 10.1038/s41586-024-07132-6. Epub 2024 Feb 28. 10.1038/s41586-024-07132-6 PubMed 38418876