Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-GFAP-eGFP-shAqp4-3
(Plasmid #223224)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223224 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV.GFAP.eGFP.WPRE.hGH
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shAqp4
  • gRNA/shRNA sequence
    CGAACTGATGTTACTGGTTCAA (the first C was added to the shRNA seq in order to have 22 mer)
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Aqp4 (a.k.a. WCH4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-GFAP-eGFP-shAqp4-3 was a gift from Li-Huei Tsai (Addgene plasmid # 223224 ; http://n2t.net/addgene:223224 ; RRID:Addgene_223224)
  • For your References section:

    Multisensory gamma stimulation promotes glymphatic clearance of amyloid. Murdock MH, Yang CY, Sun N, Pao PC, Blanco-Duque C, Kahn MC, Kim T, Lavoie NS, Victor MB, Islam MR, Galiana F, Leary N, Wang S, Bubnys A, Ma E, Akay LA, Sneve M, Qian Y, Lai C, McCarthy MM, Kopell N, Kellis M, Piatkevich KD, Boyden ES, Tsai LH. Nature. 2024 Mar;627(8002):149-156. doi: 10.1038/s41586-024-07132-6. Epub 2024 Feb 28. 10.1038/s41586-024-07132-6 PubMed 38418876