pAAV-GFAP-eGFP-shAqp4-1
(Plasmid
#223223)
-
Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223223 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV.GFAP.eGFP.WPRE.hGH
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshAqp4
-
gRNA/shRNA sequenceGACCCGCAGTTATCATGGGAAA (the first G was added to the shRNA seq in order to have 22 mer)
-
SpeciesM. musculus (mouse)
-
Entrez GeneAqp4 (a.k.a. WCH4)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-GFAP-eGFP-shAqp4-1 was a gift from Li-Huei Tsai (Addgene plasmid # 223223 ; http://n2t.net/addgene:223223 ; RRID:Addgene_223223) -
For your References section:
Multisensory gamma stimulation promotes glymphatic clearance of amyloid. Murdock MH, Yang CY, Sun N, Pao PC, Blanco-Duque C, Kahn MC, Kim T, Lavoie NS, Victor MB, Islam MR, Galiana F, Leary N, Wang S, Bubnys A, Ma E, Akay LA, Sneve M, Qian Y, Lai C, McCarthy MM, Kopell N, Kellis M, Piatkevich KD, Boyden ES, Tsai LH. Nature. 2024 Mar;627(8002):149-156. doi: 10.1038/s41586-024-07132-6. Epub 2024 Feb 28. 10.1038/s41586-024-07132-6 PubMed 38418876