Lenti:FlipGFP-T2A-mCherry
(Plasmid #223198)

• Purpose: Lentiviral vector encoding FlipGFP-T2A-mCherry (w/ caspase-3 cleave site in FlipGFP for restoring GFP conformation)
• Depositing Lab: Yeh-Hsing Lao
• Publication: Chi et al Lab Chip. 2024 Jan 30;24(3):396-407. doi: 10.1039/d3lc00662j.

Backbone

• Vector backbone: Addgene #61422
• Backbone manufacturer: Addgene
• Modifications to backbone: dCas9VP64-T2A-EGFP in Addgene #61422 was swapped with FlipGFP-T2A-mCherry (retrieved from Addgene #124428)
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: FlipGFP-T2A-mCherry
• Species: Synthetic
• Promoter: EF1a

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsiWI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Xiaokun Shu and Feng Zhang (Addgene plasmids #124428 and #61422 respectively).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry