pENTR-FLAG-HAND1-T2A-mTagBFP2
(Plasmid
#223192)
-
PurposeEntry vector containing FLAG-HAND1 with a T2A-mTagBFP2 reporter (attL flanked)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223192 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepENTR4-FLAG
-
Backbone manufacturerAddgene ID 17423
- Backbone size w/o insert (bp) 2276
- Total vector size (bp) 3740
-
Vector typeBacterial Expression ; Promoterless entry vector for Gateway cloning
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHAND1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1464
-
GenBank IDNM_004821.3
-
Entrez GeneHAND1 (a.k.a. Hxt, Thing1, bHLHa27, eHand)
- Promoter None
-
Tags
/ Fusion Proteins
- FLAG (N terminal on insert)
- T2A-mTagBFP2 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTACAAACTCTTCCTGTTAGTTAG
- 3′ sequencing primer ATGGCTCATAACACCCCTTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR-FLAG-HAND1-T2A-mTagBFP2 was a gift from Matthew Birket (Addgene plasmid # 223192 ; http://n2t.net/addgene:223192 ; RRID:Addgene_223192) -
For your References section:
HAND1 level controls the specification of multipotent cardiac and extraembryonic progenitors from human pluripotent stem cells. Lynch AT, Phillips N, Douglas M, Dorgnach M, Lin IH, Adamson AD, Darieva Z, Whittle J, Hanley NA, Bobola N, Birket MJ. EMBO J. 2025 Mar 31. doi: 10.1038/s44318-025-00409-0. 10.1038/s44318-025-00409-0 PubMed 40164946