pdest N-FLAG METTL1-WT puro
(Plasmid
#223055)
-
PurposeMETTL1-WT gene expression in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223055 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepdest Puro
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMETTL1-WT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)852
-
Entrez GeneMETTL1 (a.k.a. C12orf1, TRM8, TRMT8, YDL201w)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pdest N-FLAG METTL1-WT puro was a gift from Alejandro Gutierrez (Addgene plasmid # 223055 ; http://n2t.net/addgene:223055 ; RRID:Addgene_223055) -
For your References section:
A methyltransferase-independent role for METTL1 in tRNA aminoacylation and oncogenic transformation. Raja H. Ali, Esteban A. Orellana, Su Hyun Lee, Yun-Cheol Chae, Yantao Chen, Jim Clauwaert, Alyssa L. Kennedy, Ashley E. Gutierrez, David J. Papke, Mateo Valenzuela, Brianna Silverman, Amanda Falzetta, Scott B. Ficarro, Jarrod A. Marto, Christopher D.M. Fletcher, Antonio Perez-Atayde, Thierry Alcindor, Akiko Shimamura, John R. Prensner, Richard I. Gregory, Alejandro Gutierrez. Molecular Cell, 2025, ISSN 1097-2765 10.1016/j.molcel.2025.01.003