Skip to main content
Addgene

rag2:MDM2_CE_pISceI
(Plasmid #223035)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223035 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Rag2 plasmid
  • Backbone size w/o insert (bp) 12500
  • Vector type
    Express the insert(gene) in mesenchymal lineage of Zebrafish.

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    MDM2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1473
  • Entrez Gene
    MDM2 (a.k.a. ACTFS, HDMX, LSKB, hdm2)
  • Promoter Rag2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHi (unknown if destroyed)
  • 3′ cloning site Clai (unknown if destroyed)
  • 5′ sequencing primer CTGTGGTAAAGCCATGGTTG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    rag2:MDM2_CE_pISceI was a gift from Alejandro Gutierrez (Addgene plasmid # 223035 ; http://n2t.net/addgene:223035 ; RRID:Addgene_223035)

  • For your References section:

    A methyltransferase-independent role for METTL1 in tRNA aminoacylation and oncogenic transformation. Raja H. Ali, Esteban A. Orellana, Su Hyun Lee, Yun-Cheol Chae, Yantao Chen, Jim Clauwaert, Alyssa L. Kennedy, Ashley E. Gutierrez, David J. Papke, Mateo Valenzuela, Brianna Silverman, Amanda Falzetta, Scott B. Ficarro, Jarrod A. Marto, Christopher D.M. Fletcher, Antonio Perez-Atayde, Thierry Alcindor, Akiko Shimamura, John R. Prensner, Richard I. Gregory, Alejandro Gutierrez. Molecular Cell, 2025, ISSN 1097-2765 10.1016/j.molcel.2025.01.003
Related items: