rag2:OS9_CE_pISceI
(Plasmid
#223023)
-
PurposeExpress OS9 gene in mesenchymal lineage of Zebrafish.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 223023 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneRag2 plasmid
- Backbone size w/o insert (bp) 12500
-
Vector typeExpress the insert(gene) in mesenchymal lineage of Zebrafish.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameOS9
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1386
-
Entrez GeneOS9 (a.k.a. ERLEC2, OS-9)
- Promoter Rag2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bcli (unknown if destroyed)
- 3′ cloning site Acil (unknown if destroyed)
- 5′ sequencing primer CTGTGGTAAAGCCATGGTTG
- 3′ sequencing primer GCCCTAGTGAGAGCCGTACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
rag2:OS9_CE_pISceI was a gift from Alejandro Gutierrez (Addgene plasmid # 223023 ; http://n2t.net/addgene:223023 ; RRID:Addgene_223023) -
For your References section:
A methyltransferase-independent role for METTL1 in tRNA aminoacylation and oncogenic transformation. Raja H. Ali, Esteban A. Orellana, Su Hyun Lee, Yun-Cheol Chae, Yantao Chen, Jim Clauwaert, Alyssa L. Kennedy, Ashley E. Gutierrez, David J. Papke, Mateo Valenzuela, Brianna Silverman, Amanda Falzetta, Scott B. Ficarro, Jarrod A. Marto, Christopher D.M. Fletcher, Antonio Perez-Atayde, Thierry Alcindor, Akiko Shimamura, John R. Prensner, Richard I. Gregory, Alejandro Gutierrez. Molecular Cell, 2025, ISSN 1097-2765 10.1016/j.molcel.2025.01.003