Skip to main content
Addgene

pMB61
(Plasmid #223014)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223014 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    LIIIβ F A-B - BB53
  • Backbone manufacturer
    Binder et al., 2014
  • Vector type
    Plant Expression, CRISPR
  • Selectable markers
    Firefly luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas12a and Csy4 with 5' and 3' targets (I)

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer GGTGGCAGGATATATTGTGGTG
  • 3′ sequencing primer CGCTCTTTTCTCTTAGGTTTACCC
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Holger Puchta (sequence of tt_At_LbCas12a).

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMB61 was a gift from Martin Parniske (Addgene plasmid # 223014 ; http://n2t.net/addgene:223014 ; RRID:Addgene_223014)

  • For your References section:

    A quantitative assay for the efficiency of RNA-guided genome editing in plants. Bircheneder M, Schreiber T, Tissier A, Parniske M. Plant J. 2024 Sep;119(5):2564-2577. doi: 10.1111/tpj.16931. Epub 2024 Jul 20. 10.1111/tpj.16931 PubMed 39032106
Related items: