Skip to main content
Addgene

pMB24
(Plasmid #223008)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223008 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    LIIIβ F A-B - BB53
  • Backbone manufacturer
    Binder et al., 2014
  • Vector type
    Plant Expression, CRISPR
  • Selectable markers
    Firefly luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Not applicable, control plasmid

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer GGTGGCAGGATATATTGTGGTG
  • 3′ sequencing primer CGCTCTTTTCTCTTAGGTTTACCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMB24 was a gift from Martin Parniske (Addgene plasmid # 223008 ; http://n2t.net/addgene:223008 ; RRID:Addgene_223008)
  • For your References section:

    A quantitative assay for the efficiency of RNA-guided genome editing in plants. Bircheneder M, Schreiber T, Tissier A, Parniske M. Plant J. 2024 Sep;119(5):2564-2577. doi: 10.1111/tpj.16931. Epub 2024 Jul 20. 10.1111/tpj.16931 PubMed 39032106