Skip to main content
Addgene

PEmax_AAVS1_knockin_HDR_donor
(Plasmid #223000)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223000 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pBluescript
  • Total vector size (bp) 15566
  • Vector type
    Mammalian Expression ; HDR donor
  • Selectable markers
    Neomycin (select with G418) ; EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PEmax
  • Species
    Synthetic; SpCas9 is from Streptococcus pyogenes; MMLV_RT is from the Moloney murine leukemia virus
  • Insert Size (bp)
    6393
  • Promoter EF1α
  • Tags / Fusion Proteins
    • SV40 bpNLS (N terminal on insert)
    • SV40 bpNLS (C terminal on insert)
    • c-Myc NLS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site BstXI (not destroyed)
  • 5′ sequencing primer CGAAAGCAGCGAGACAGG
  • 3′ sequencing primer TGGCTCTCCTCAAGCGTATT
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PEmax_AAVS1_knockin_HDR_donor was a gift from Brittany Adamson (Addgene plasmid # 223000 ; http://n2t.net/addgene:223000 ; RRID:Addgene_223000)

  • For your References section:

    Improving prime editing with an endogenous small RNA-binding protein. Yan J, Oyler-Castrillo P, Ravisankar P, Ward CC, Levesque S, Jing Y, Simpson D, Zhao A, Li H, Yan W, Goudy L, Schmidt R, Solley SC, Gilbert LA, Chan MM, Bauer DE, Marson A, Parsons LR, Adamson B. Nature. 2024 Apr 3. doi: 10.1038/s41586-024-07259-6. 10.1038/s41586-024-07259-6 PubMed 38570691
Related items:
Commonly requested with: