pSFFV-EGFP-IRES2-mCherry (FACS reporter)
(Plasmid
#222999)
-
PurposeFACS reporter constitutively expressing mCherry and conditionally expressing EGFP upon prime editing. For lentivirus packaging.
-
Depositing Lab
-
Sequence Information
-
Please contact us if you would like Addgene to sequence a portion of this plasmid before you request it.
-
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 222999 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneN/A
- Total vector size (bp) 8408
-
Vector typeLentiviral
-
Selectable markersmCherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP-IRES2-mCherry
-
SpeciesSynthetic
- Promoter SFFV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTTCCCGAGCTCTATAAAAGAGC
- 3′ sequencing primer GCAGCGTATCCACATAGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSFFV-EGFP-IRES2-mCherry (FACS reporter) was a gift from Brittany Adamson (Addgene plasmid # 222999) -
For your References section:
Improving prime editing with an endogenous small RNA-binding protein. Yan J, Oyler-Castrillo P, Ravisankar P, Ward CC, Levesque S, Jing Y, Simpson D, Zhao A, Li H, Yan W, Goudy L, Schmidt R, Solley SC, Gilbert LA, Chan MM, Bauer DE, Marson A, Parsons LR, Adamson B. Nature. 2024 Apr 3. doi: 10.1038/s41586-024-07259-6. 10.1038/s41586-024-07259-6 PubMed 38570691