pSFFV-IGKleader-hIgG1_FC-Myc-PDGFRb-IRES2-EGFP (MCS reporter)
(Plasmid
#222998)
-
PurposeMCS reporter constitutively expressing EGFP and conditionally expressing a synthetic cell surface protein upon prime editing. For lentivirus packaging.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 222998 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepALD EGFP A
- Total vector size (bp) 8865
-
Vector typeLentiviral
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIGKleader-hIgG1_FC-Myc-PDGFRb-IRES2-EGFP
-
SpeciesSynthetic
- Promoter SFFV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTTCCCGAGCTCTATAAAAGAGC
- 3′ sequencing primer GCAGCGTATCCACATAGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSFFV-IGKleader-hIgG1_FC-Myc-PDGFRb-IRES2-EGFP (MCS reporter) was a gift from Brittany Adamson (Addgene plasmid # 222998 ; http://n2t.net/addgene:222998 ; RRID:Addgene_222998) -
For your References section:
Improving prime editing with an endogenous small RNA-binding protein. Yan J, Oyler-Castrillo P, Ravisankar P, Ward CC, Levesque S, Jing Y, Simpson D, Zhao A, Li H, Yan W, Goudy L, Schmidt R, Solley SC, Gilbert LA, Chan MM, Bauer DE, Marson A, Parsons LR, Adamson B. Nature. 2024 Apr 3. doi: 10.1038/s41586-024-07259-6. 10.1038/s41586-024-07259-6 PubMed 38570691