Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

HuEx-2xNLS-iGeoCas9(C2)-2xNLS_EGFP-g1
(Plasmid #222994)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 222994 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    N/A
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HuEx-2xNLS-iGeoCas9(C2)-2xNLS_EGFP-g1
  • Alt name
    iGeoCas9(C2)_EGFP-g1
  • Species
    Synthetic
  • Promoter pCAG
  • Tag / Fusion Protein
    • Puro (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (unknown if destroyed)
  • 3′ cloning site MluI (unknown if destroyed)
  • 5′ sequencing primer tttcaggttggaccggtgccacct
  • 3′ sequencing primer tcgaggctgatcagcgagctcta
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HuEx-2xNLS-iGeoCas9(C2)-2xNLS_EGFP-g1 was a gift from Jennifer Doudna (Addgene plasmid # 222994 ; http://n2t.net/addgene:222994 ; RRID:Addgene_222994)
  • For your References section:

    Rapid DNA unwinding accelerates genome editing by engineered CRISPR-Cas9. Eggers AR, Chen K, Soczek KM, Tuck OT, Doherty EE, Xu B, Trinidad MI, Thornton BW, Yoon PH, Doudna JA. Cell. 2024 May 13:S0092-8674(24)00457-4. doi: 10.1016/j.cell.2024.04.031. 10.1016/j.cell.2024.04.031 PubMed 38781968