CL7_2xNLS_iGeoCas9(C1)_2xNLS_His
(Plasmid #222987)

• Purpose: Bacterial expression of iGeoCas9(C1) construct
• Depositing Lab: Jennifer Doudna
• Publication: Chen et al bioRxiv [Preprint]. 2023 Nov 15:2023.11.15.566339. doi: 10.1101/2023.11.15.566339.

Backbone

• Vector backbone: pCold
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: The Doudna lab uses BL21 Rosetta E. coli for protein expression.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CL7_2xNLS_iGeoCas9(C1)_2xNLS_His
• Alt name: 2x-iGeoCas9(R1-GRK)-2x
• Species: Synthetic
• Insert Size (bp): 3891
• Promoter: tac
• Tags / Fusion Proteins:
  • His (C terminal on insert)
  • CL7 (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: agcggataacaatttgatgtgc
• 3′ sequencing primer: ATAATACCGCGCCACATAGC

Resource Information

• Supplemental Documents:
  • CL7_2xNLS_iGeoCas9(C1)_2xNLS_His.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry