Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

His_CL7_2NLS_iCas12a-4NLS
(Plasmid #222971)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 222971 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCold
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    The Doudna lab uses BL21 Rosetta E. coli for protein expression.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    His_CL7_2NLS_iCas12a-4NLS
  • Alt name
    2x-iCas12a-4x
  • Species
    Synthetic
  • Insert Size (bp)
    4359
  • Promoter tac
  • Tags / Fusion Proteins
    • His (N terminal on insert)
    • CL7 (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer agcggataacaatttgatgtgc
  • 3′ sequencing primer ATAATACCGCGCCACATAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    His_CL7_2NLS_iCas12a-4NLS was a gift from Jennifer Doudna (Addgene plasmid # 222971 ; http://n2t.net/addgene:222971 ; RRID:Addgene_222971)
  • For your References section:

    Engineering self-deliverable ribonucleoproteins for genome editing in the brain. Chen K, Stahl EC, Kang MH, Xu B, Allen R, Trinidad M, Doudna JA. Nat Commun. 2024 Feb 26;15(1):1727. doi: 10.1038/s41467-024-45998-2. 10.1038/s41467-024-45998-2 PubMed 38409124