pLentiCRISPRv1-49535-sgFmr1_CGG5-2
(Plasmid
#222964)
-
PurposeTargeting FMR1 5' UTR for CGG deletion
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 222964 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiCRISPR
-
Backbone manufacturerFeng Zhang (Addgene #49535)
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFMR1 sgRNA
-
gRNA/shRNA sequenceCCAGGGGGCGTGCGGCAGCG
-
SpeciesH. sapiens (human)
-
Entrez GeneFMR1 (a.k.a. FMRP, FRAXA, POF, POF1)
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPRv1-49535-sgFmr1_CGG5-2 was a gift from Xinyu Zhao (Addgene plasmid # 222964 ; http://n2t.net/addgene:222964 ; RRID:Addgene_222964) -
For your References section:
CGG repeats in the human FMR1 gene regulate mRNA localization and cellular stress in developing neurons. Sirois CL, Guo Y, Li M, Wolkoff NE, Korabelnikov T, Sandoval S, Lee J, Shen M, Contractor A, Sousa AMM, Bhattacharyya A, Zhao X. Cell Rep. 2024 Jun 11;43(6):114330. doi: 10.1016/j.celrep.2024.114330. 10.1016/j.celrep.2024.114330 PubMed 38865241