Skip to main content
Addgene

pSems meGFP-farnesyl
(Plasmid #222949)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 222949 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSEMS(26m)
  • Backbone manufacturer
    EMD Biosciences
  • Backbone size w/o insert (bp) 5190
  • Total vector size (bp) 6000
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    C-terminal fragment of HRAS (170-189)
  • Alt name
    HRAS
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    810
  • Mutation
    C-terminal fragment of HRAS (170-189)
  • Entrez Gene
    HRAS (a.k.a. C-BAS/HAS, C-H-RAS, C-HA-RAS1, CTLO, H-RASIDX, HAMSV, HRAS1, RASH1, p21ras)
  • Promoter CMV
  • Tag / Fusion Protein
    • mEGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAACAGCTGGCCCTCGCAGA
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSems meGFP-farnesyl was a gift from Jacob Piehler (Addgene plasmid # 222949 ; http://n2t.net/addgene:222949 ; RRID:Addgene_222949)

  • For your References section:

    Correlative single-molecule and structured illumination microscopy of fast dynamics at the plasma membrane. Winkelmann H, Richter CP, Eising J, Piehler J, Kurre R. Nat Commun. 2024 Jul 10;15(1):5813. doi: 10.1038/s41467-024-49876-9. 10.1038/s41467-024-49876-9 PubMed 38987559
Related items: