Skip to main content
Addgene
Open Menu

pSems StayGold-2xFYVE
(Plasmid #222948)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 222948 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 222948-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 222948-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pSEMS(26m)
  • Backbone manufacturer
    EMD Biosciences
  • Backbone size w/o insert (bp) 5202
  • Total vector size (bp) 6413
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tandem HRS FYVE domain
  • Alt name
    Hrs
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1211
  • Entrez Gene
    Hgs (a.k.a. Hgr, Hrs, ZFYVE8, tn)
  • Promoter CMV
  • Tag / Fusion Protein
    • StayGold (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAACAGCTGGCCCTCGCAGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

StayGold from Addgene #185823
Hirano M, Ando R, Shimozono S, Sugiyama M, Takeda N, Kurokawa H, Deguchi R, Endo K, Haga K, Takai-Todaka R, Inaura S, Matsumura Y, Hama H, Okada Y, Fujiwara T, Morimoto T, Katayama K, Miyawaki A. A highly photostable and bright green fluorescent protein. Nat Biotechnol. 2022 Jul;40(7):1132-1142. doi: 10.1038/s41587-022-01278-2. Epub 2022 Apr 25. Erratum in: Nat Biotechnol. 2022 Sep;40(9):1412. doi: 10.1038/s41587-022-01469-x. PMID: 35468954; PMCID: PMC9287174.

2xFYVE from Addgene #140047
Gillooly DJ, Morrow IC, Lindsay M, Gould R, Bryant NJ, Gaullier JM, Parton RG, Stenmark H. Localization of phosphatidylinositol 3-phosphate in yeast and mammalian cells. EMBO J. 2000 Sep 1;19(17):4577-88. doi: 10.1093/emboj/19.17.4577. PMID: 10970851; PMCID: PMC302054.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSems StayGold-2xFYVE was a gift from Jacob Piehler (Addgene plasmid # 222948 ; http://n2t.net/addgene:222948 ; RRID:Addgene_222948)

  • For your References section:

    Correlative single-molecule and structured illumination microscopy of fast dynamics at the plasma membrane. Winkelmann H, Richter CP, Eising J, Piehler J, Kurre R. Nat Commun. 2024 Jul 10;15(1):5813. doi: 10.1038/s41467-024-49876-9. 10.1038/s41467-024-49876-9 PubMed 38987559
Related items:
Commonly requested with: