pOSV00157
(Plasmid
#222937)
-
PurposeKill switch plasmid for DNA sensor construction using Bacillus subtilis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 222937 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneColE1
-
Vector typeBacterial Expression
-
Selectable markersSpectinomycin resistance gene for Bacillus subtilis genomic integration at amyE locus
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsThe leaky expression of the toxin on the plasmid could lead to outgrowing mutants. It is suggested that a few colonies can be streaked for growth and plasmid extraction. The plasmid extraction should be done before the OD gets too high.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTxpA-RatA toxin-antitoxin
-
SpeciesBacillus subtilis
- Promoter Phyperspank
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTTGAGGCATCAAATAAAACGAAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOSV00157 was a gift from Ophelia Venturelli (Addgene plasmid # 222937 ; http://n2t.net/addgene:222937 ; RRID:Addgene_222937) -
For your References section:
Programming bacteria for multiplexed DNA detection. Cheng YY, Chen Z, Cao X, Ross TD, Falbel TG, Burton BM, Venturelli OS. Nat Commun. 2023 Apr 10;14(1):2001. doi: 10.1038/s41467-023-37582-x. 10.1038/s41467-023-37582-x PubMed 37037805