Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p1153
(Plasmid #222930)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 222930 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pBluescript SK+
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 2958
  • Total vector size (bp) 6611
  • Modifications to backbone
    Contains a Nourseothricin resistance marker (NAT1) cassettewith Candida albicans actin promoter and terminator. Contains candida auris B8441 CEN 4 sequence
  • Vector type
    Bacterial Expression
  • Selectable markers
    Nourseothricin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CEN 4
  • Species
    Candida auris
  • Insert Size (bp)
    1721

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TTTGAAGTTGGCTGTGATGGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p1153 was a gift from Brian Wickes (Addgene plasmid # 222930 ; http://n2t.net/addgene:222930 ; RRID:Addgene_222930)
  • For your References section:

    Development of a Shuttle Vector That Transforms at High Frequency for the Emerging Human Fungal Pathogen: Candida auris. Brenden Determann II , Jianmin Fu and Brian L. Wickes. J. Fungi 2024, 10(7), 477 10.3390/jof10070477