p1153
(Plasmid
#222930)
-
PurposeShuttle vector carrying a Candida auris centromere (CEN 4) with Nourseothricin selectable marker
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 222930 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepBluescript SK+
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 2958
- Total vector size (bp) 6611
-
Modifications to backboneContains a Nourseothricin resistance marker (NAT1) cassettewith Candida albicans actin promoter and terminator. Contains candida auris B8441 CEN 4 sequence
-
Vector typeBacterial Expression
-
Selectable markersNourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCEN 4
-
SpeciesCandida auris
-
Insert Size (bp)1721
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TTTGAAGTTGGCTGTGATGGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p1153 was a gift from Brian Wickes (Addgene plasmid # 222930 ; http://n2t.net/addgene:222930 ; RRID:Addgene_222930) -
For your References section:
Development of a Shuttle Vector That Transforms at High Frequency for the Emerging Human Fungal Pathogen: Candida auris. Brenden Determann II , Jianmin Fu and Brian L. Wickes. J. Fungi 2024, 10(7), 477 10.3390/jof10070477