Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO.1 mTagBFP2 rat DJ-1 shRNA
(Plasmid #222870)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 222870 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO.1 - TRC mTagBFP2
  • Backbone size w/o insert (bp) 7073
  • Total vector size (bp) 7135
  • Vector type
    Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DJ-1 shRNA
  • Alt name
    park7
  • gRNA/shRNA sequence
    ATCTGGGTGCACAGAACTTAT
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    Park7 (a.k.a. CAP1, DJ-1, Dj1, SP22)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer U6
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.10.10.561760 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1 mTagBFP2 rat DJ-1 shRNA was a gift from Timothy Ryan (Addgene plasmid # 222870 ; http://n2t.net/addgene:222870 ; RRID:Addgene_222870)
  • For your References section:

    Phosphoglycerate kinase is a central leverage point in Parkinson's Disease driven neuronal metabolic deficits. Kokotos AC, Antoniazzi AM, Unda SR, Ko MS, Park D, Eliezer D, Kaplitt MG, Camilli P, Ryan TA. bioRxiv [Preprint]. 2023 Oct 10:2023.10.10.561760. doi: 10.1101/2023.10.10.561760. 10.1101/2023.10.10.561760 PubMed 37873141