Skip to main content
Addgene

pLKO.1 mTagBFP2 rat PGK1 shRNA
(Plasmid #222869)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 222869 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLKO.1 - TRC mTagBFP2
  • Backbone size w/o insert (bp) 7073
  • Total vector size (bp) 7135
  • Vector type
    Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PGK1 shRNA
  • Alt name
    phosphoglycerate kinase 1
  • gRNA/shRNA sequence
    GCTAAGCAGATTGTTTGGAAT
  • Species
    M. musculus (mouse), R. norvegicus (rat)
  • Entrez Gene
    Pgk1 (a.k.a. Pgk-1)
  • Entrez Gene
    Pgk1 (a.k.a. Pgk)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer U6
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.10.10.561760 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1 mTagBFP2 rat PGK1 shRNA was a gift from Timothy Ryan (Addgene plasmid # 222869 ; http://n2t.net/addgene:222869 ; RRID:Addgene_222869)

  • For your References section:

    Phosphoglycerate kinase is a central leverage point in Parkinson's disease-driven neuronal metabolic deficits. Kokotos AC, Antoniazzi AM, Unda SR, Ko MS, Park D, Eliezer D, Kaplitt MG, De Camilli P, Ryan TA. Sci Adv. 2024 Aug 23;10(34):eadn6016. doi: 10.1126/sciadv.adn6016. Epub 2024 Aug 21. 10.1126/sciadv.adn6016 PubMed 39167658
Related items: