Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMH4-SYN-EGFP-ER
(Plasmid #22285)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 22285 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMH4
  • Backbone size w/o insert (bp) 6959
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5a or JM 109 high efficiency
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    EGFP-ER
  • Alt name
    EGFP(A206K)mut-ER
  • Species
    mixture
  • Insert Size (bp)
    863
  • Mutation
    EGFP alanine 206 changed to Lysin
  • Tag / Fusion Protein
    • EGFP-ER

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer gactcagcgctgcctcagtctg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

EGFP(A206K)= 925-1707
Calreticulin sgnalseq.=862-912
KDEL coding seq.=1714-1725

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMH4-SYN-EGFP-ER was a gift from Thomas Oertner (Addgene plasmid # 22285 ; http://n2t.net/addgene:22285 ; RRID:Addgene_22285)
  • For your References section:

    Differential distribution of endoplasmic reticulum controls metabotropic signaling and plasticity at hippocampal synapses. Holbro N, Grunditz A, Oertner TG. Proc Natl Acad Sci U S A. 2009 Aug 18. ():. 10.1073/pnas.0905110106 PubMed 19706463