pMH4-SYN-EGFP-ER
(Plasmid #22285)

• Depositing Lab: Thomas Oertner
• Publication: Holbro et al Proc Natl Acad Sci U S A. 2009 Aug 18. ():.

Backbone

• Vector backbone: pMH4
• Backbone size w/o insert (bp): 6959
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: DH5a or JM 109 high efficiency
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: EGFP-ER
• Alt name: EGFP(A206K)mut-ER
• Species: mixture
• Insert Size (bp): 863
• Mutation: EGFP alanine 206 changed to Lysin
• Tag / Fusion Protein:
  • EGFP-ER

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: gactcagcgctgcctcagtctg

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

EGFP(A206K)= 925-1707
Calreticulin sgnalseq.=862-912
KDEL coding seq.=1714-1725