pIND4-GFP-MmXYRS
(Plasmid #222745)

• Purpose: Expresses sfGFP and aaRS-tRNA pair for incorporating haloalkane crosslinker
• Depositing Lab: Steven Boxer
• Publication: Reaction center amber suppression plasmids (unpublished)

Backbone

• Vector backbone: pIND4
• Backbone size w/o insert (bp): 9193
• Total vector size (bp): 11374

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: sfGFP
• Species: Aequorea victoria
• Insert Size (bp): 744
• Tag / Fusion Protein:
  • 6xHis (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AATAGGCGTATCACGAGGCC

Gene/Insert 2

• Gene/Insert name: MmXYRS
• Species: Methanosarcina mazei
• Insert Size (bp): 1365
• Mutation: Contains the following substitutions: V346A, W348A, L401V, and W417T from MmOmeRS
• Promoter: rrnB

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCGCTTCTTTGAGCGAACGATC

Gene/Insert 3

• Gene/Insert name: Mm Pyl tRNA
• Species: Methanosarcina mazei
• Insert Size (bp): 72
• Promoter: rrnB

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CATCAGCCCTgAGGTCGGGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry