pTZ18U-pufLM-Clonable
(Plasmid
#222743)
-
PurposeEncodes L-subunit and M-subunit of bacterial photosynthetic reaction center in R. sphaeroides
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 222743 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTZ18U
- Backbone size w/o insert (bp) 2858
- Total vector size (bp) 4634
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namepufL
-
SpeciesRhodobacter sphaeroides
-
Insert Size (bp)849
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site None (unknown if destroyed)
- 5′ sequencing primer gttgtgtggaattgtgagcggataac (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepufM
-
SpeciesRhodobacter sphaeroides
-
Insert Size (bp)927
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site None (unknown if destroyed)
- 3′ cloning site NdeI (unknown if destroyed)
- 5′ sequencing primer gttgtgtggaattgtgagcggataac (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTZ18U-pufLM-Clonable was a gift from Steven Boxer (Addgene plasmid # 222743 ; http://n2t.net/addgene:222743 ; RRID:Addgene_222743)