pAAV-Syn-CD4-sTC-M13-GFP-IRES-CaM-V5-sTN
(Plasmid
#222742)
-
PurposeCaST-IRES for neuron expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 222742 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCD4-sTC-M13-GFP-IRES-CaM-V5-sTN
-
SpeciesSynthetic
- Promoter Synapsin
-
Tags
/ Fusion Proteins
- V5
- HA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer actcagcgctgcctcagtctgc
- 3′ sequencing primer GATCAGCGAGCTCTAGctcgag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Syn-CD4-sTC-M13-GFP-IRES-CaM-V5-sTN was a gift from Christina Kim (Addgene plasmid # 222742 ; http://n2t.net/addgene:222742 ; RRID:Addgene_222742) -
For your References section:
Rapid, biochemical tagging of cellular activity history in vivo. Zhang R, Anguiano M, Aarrestad IK, Lin S, Chandra J, Vadde SS, Olson DE, Kim CK. Nat Methods. 2024 Sep;21(9):1725-1735. doi: 10.1038/s41592-024-02375-7. Epub 2024 Aug 5. 10.1038/s41592-024-02375-7 PubMed 39103446