pSF511
(Plasmid
#222719)
-
PurposeCRISPR/Cas9 plasmid with gRNA1 for site gsdA, Cas9
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 222719 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMST665_BB3_L 23_gRNAempty_cas9_BbsI
-
Backbone manufacturerMichael Sauer (Sarkari et al. 2017) Addgene #90278
- Total vector size (bp) 14715
-
Vector typeBacterial Expression, CRISPR ; A. niger
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Hygromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA1(gsdA)
-
gRNA/shRNA sequenceACGGTGGTGAAAACGCTGGG
- Promoter pmbfA
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer GGAGGTACAGTGGCCATGAAATCCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSF511 was a gift from Matthias Steiger (Addgene plasmid # 222719 ; http://n2t.net/addgene:222719 ; RRID:Addgene_222719) -
For your References section:
Regulation of the Glucose-6-phosphate dehydrogenase encoding gene gsdA and its impact on growth and citric acid production in Aspergillus niger. Matthias Steiger. PLOS One 10.1371/journal.pone.0321363