Skip to main content
Addgene

pScalps-Puro-FLAG-HA-Regnase-3 D252N
(Plasmid #222664)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 222664 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pScalps-Puro
  • Backbone size w/o insert (bp) 7740
  • Total vector size (bp) 10492
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Zc3h12c
  • Alt name
    Mcpip3, Reg-3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2745
  • Mutation
    mutated aspartic acid 252 to asparagine to abrogate RNase activity
  • Entrez Gene
    Zc3h12c (a.k.a. A230108E06, C230027N18Rik, mKIAA1726)
  • Promoter SFFV
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AfeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GCTTCTCGCTTCTGTTCG
  • 3′ sequencing primer gttgtcaagcgatgaggcgcgt
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pScalps-Puro-FLAG-HA-Regnase-3 D252N was a gift from Silvia Monticelli (Addgene plasmid # 222664 ; http://n2t.net/addgene:222664 ; RRID:Addgene_222664)

  • For your References section:

    Crosstalk between Regnase-1 and -3 shapes mast cell survival and cytokine expression. Bataclan M, Leoni C, Moro SG, Pecoraro M, Wong EH, Heissmeyer V, Monticelli S. Life Sci Alliance. 2024 Jun 3;7(8):e202402784. doi: 10.26508/lsa.202402784. Print 2024 Aug. 10.26508/lsa.202402784 PubMed 38830770
Related items: