Skip to main content
Addgene

pmiRGLO-Zc3h12a 3’UTR
(Plasmid #222662)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 222662 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pmirGLO Dual-Luciferase miRNA Target Expression Vector
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 7362
  • Total vector size (bp) 8142
  • Modifications to backbone
    added EcoRI and SmaI restriction enzyme sites in the multiple cloning site
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Zc3h12a 3'UTR
  • Alt name
    Mcpip1, Reg-1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    786
  • Entrez Gene
    Zc3h12a (a.k.a. MCPIP, MCPIP-1, Mcpip1, Reg1)
  • Promoter PGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer AGAAGCTGCGCGGTGGTGTTGTG
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

There is a single G nucleotide missing within the last 10 nucleotides of the Zc3h12a 3'UTR, which does not affect the functionality of the gene insert nor the plasmid itself.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmiRGLO-Zc3h12a 3’UTR was a gift from Silvia Monticelli (Addgene plasmid # 222662 ; http://n2t.net/addgene:222662 ; RRID:Addgene_222662)

  • For your References section:

    Crosstalk between Regnase-1 and -3 shapes mast cell survival and cytokine expression. Bataclan M, Leoni C, Moro SG, Pecoraro M, Wong EH, Heissmeyer V, Monticelli S. Life Sci Alliance. 2024 Jun 3;7(8):e202402784. doi: 10.26508/lsa.202402784. Print 2024 Aug. 10.26508/lsa.202402784 PubMed 38830770
Related items: